Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-8109 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-8109 Accession Number: MIMAT0031415 Mature Sequence: GCGCCGCGUGCCGGCCGCGGG mmu-miR-8109 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-8109 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-8109 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

β1-Adaptin CRISPR Activation Plasmid (h)
sc-402948-ACT 20 µg

β1-Adaptin CRISPR Activation Plasmid (h)

Sign In for Pricing
View Details
GABRR2 (NM_002043) Human Untagged Clone
SC123929 10 µg

GABRR2 (NM_002043) Human Untagged Clone

Sign In for Pricing
View Details
TMEM108 (NM_023943) Human Tagged ORF Clone
RG200953 10 µg

TMEM108 (NM_023943) Human Tagged ORF Clone

Sign In for Pricing
View Details
Mfsd6l Mouse shRNA Lentiviral Particle (Locus ID 215723)
TL506455V 500 µL Each

Mfsd6l Mouse shRNA Lentiviral Particle (Locus ID 215723)

Sign In for Pricing
View Details
Inhibitor hsa-miR-4712-3p AAV miRNA Vector
Amh3167300 500 ng

Inhibitor hsa-miR-4712-3p AAV miRNA Vector

Sign In for Pricing
View Details
500g L-Glutamine Powder
61-030-RO 1 Each

500g L-Glutamine Powder

Sign In for Pricing
View Details