Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4804-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4804-3p Accession Number: MIMAT0019985 Mature Sequence: UGCUUAACCUUGCCCUCGAAA hsa-miR-4804-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4804-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4804-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

Flg (h2):293T Lysate
sc-113614 100 µg/200 µL

Flg (h2):293T Lysate

Ask
View Details
Cat Dipeptidyl Peptidase IV ELISA Kit
MBS086280 Inquire

Cat Dipeptidyl Peptidase IV ELISA Kit

Ask
View Details
PLRG1 (E-12) Alexa Fluor® 647
sc-376171 AF647 200 µg/mL

PLRG1 (E-12) Alexa Fluor® 647

Ask
View Details
ABLIM3 CRISPR All-in-one AAV vector set (with saCas9)(Mouse)
11111154 3x1.0μg DNA

ABLIM3 CRISPR All-in-one AAV vector set (with saCas9)(Mouse)

Ask
View Details
Avian Influenza Virus H5 Real Time RT-PCR Kit
PDHS-CR004 25 Tests

Avian Influenza Virus H5 Real Time RT-PCR Kit

Ask
View Details