Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-3146 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-3146 Accession Number: MIMAT0015018 Mature Sequence: CAUGCUAGGAUAGAAAGAAUGG hsa-miR-3146 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-3146 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-3146 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

Recombinant Burkholderia pseudomallei NADH-quinone oxidoreductase subunit H (nuoH), partial
MBS1009050-01 1 mg (E-Coli)

Recombinant Burkholderia pseudomallei NADH-quinone oxidoreductase subunit H (nuoH), partial

Ask
View Details
Recombinant Burkholderia pseudomallei NADH-quinone oxidoreductase subunit H (nuoH), partial
MBS1009050-02 1 mg (Yeast)

Recombinant Burkholderia pseudomallei NADH-quinone oxidoreductase subunit H (nuoH), partial

Ask
View Details
PLUNC Double Nickase Plasmid (h)
sc-416774-NIC 20 µg

PLUNC Double Nickase Plasmid (h)

Ask
View Details
ADD2  polyclonal antibody
BS79182 50ul

ADD2 polyclonal antibody

Ask
View Details
Cat Triglyceride Lipase ELISA Kit
MBS106721 Inquire

Cat Triglyceride Lipase ELISA Kit

Ask
View Details
Dog Adenosine receptor A2b, ADORA2B ELISA Kit
MBS9318313-01 48 Well

Dog Adenosine receptor A2b, ADORA2B ELISA Kit

Ask
View Details