Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4537 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4537 Accession Number: MIMAT0019080 Mature Sequence: UGAGCCGAGCUGAGCUUAGCUG hsa-miR-4537 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4537 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4537 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

LRRFIP1 (Leucine-rich Repeat Flightless-interacting Protein 1, LRR FLII-interacting Protein 1, GC-binding Factor 2, TAR RNA-interacting Protein, GCF2, TRIP, MGC10947, MGC119738, MGC119739, GCF-2, HUFI-1)
146814 100 µg

LRRFIP1 (Leucine-rich Repeat Flightless-interacting Protein 1, LRR FLII-interacting Protein 1, GC-binding Factor 2, TAR RNA-interacting Protein, GCF2, TRIP, MGC10947, MGC119738, MGC119739, GCF-2, HUFI-1)

Sign In for Pricing
View Details
Rabbit Polyclonal Amphiphysin/AMPH Antibody
NBP1-86033-25ul 25 µL

Rabbit Polyclonal Amphiphysin/AMPH Antibody

Sign In for Pricing
View Details
Recombinant Hepatitis C Virus Nucleocapsid (core) Genotype-3a
7-07187 500 µg

Recombinant Hepatitis C Virus Nucleocapsid (core) Genotype-3a

Sign In for Pricing
View Details
Olr1012 (NM_001000071) Rat Tagged ORF Clone Lentiviral Particle
RR203808L4V 200 µL

Olr1012 (NM_001000071) Rat Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
Human MSR1 Protein, His Tag
KMPH6092 50 µg

Human MSR1 Protein, His Tag

Sign In for Pricing
View Details
Mmu-miR-3075-5p miRNA Mimic
CMM0724-01 5 nmol

Mmu-miR-3075-5p miRNA Mimic

Sign In for Pricing
View Details