Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-664a-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-664a-3p Accession Number: MIMAT0005949 Mature Sequence: UAUUCAUUUAUCCCCAGCCUACA hsa-miR-664a-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-664a-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-664a-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

NDUFB5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
31650066 1.0 µg DNA

NDUFB5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

Ask
View Details
KRTAP2-3 (NM_001165252) Human Untagged Clone
SC328197 10 µg

KRTAP2-3 (NM_001165252) Human Untagged Clone

Ask
View Details
H+/K+ ATPase β CRISPR/Cas9 KO Plasmid (m)
sc-419245 20 µg

H+/K+ ATPase β CRISPR/Cas9 KO Plasmid (m)

Ask
View Details
c-Fgr shRNA Plasmid (m)
sc-39230-SH 20 µg

c-Fgr shRNA Plasmid (m)

Ask
View Details
GSTP1 (Glutathione S-transferase P, GST Class-pi, GSTP1-1, FAEES3, GST3) APC
MBS6136887-01 0.1 mL

GSTP1 (Glutathione S-transferase P, GST Class-pi, GSTP1-1, FAEES3, GST3) APC

Ask
View Details
GSTP1 (Glutathione S-transferase P, GST Class-pi, GSTP1-1, FAEES3, GST3) APC
MBS6136887-02 5x 0.1 mL

GSTP1 (Glutathione S-transferase P, GST Class-pi, GSTP1-1, FAEES3, GST3) APC

Ask
View Details