Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-630 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-630 Accession Number: MIMAT0003299 Mature Sequence: AGUAUUCUGUACCAGGGAAGGU hsa-miR-630 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-630 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-630 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

L-689502
HY-U00261 Inquire

L-689502

Ask
View Details
Homeobox protein aristaless-Like 3 (ALX3) Human ELISA Kit
E0864 96 Tests

Homeobox protein aristaless-Like 3 (ALX3) Human ELISA Kit

Ask
View Details
Goat Toll Like Receptor 1 (TLR-1) ELISA kit
EIA06449Go 96 Well

Goat Toll Like Receptor 1 (TLR-1) ELISA kit

Ask
View Details
Human Transmembrane and immunoglobulin domain-containing protein 1 (TMIGD1) Elisa Kit
EK715719 96 Well

Human Transmembrane and immunoglobulin domain-containing protein 1 (TMIGD1) Elisa Kit

Ask
View Details
Rabbit Polyclonal NEU3 Antibody
NBP3-04868-20ul 20 µL

Rabbit Polyclonal NEU3 Antibody

Ask
View Details
Rslcan-8 Double Nickase Plasmid (m)
sc-435266-NIC 20 µg

Rslcan-8 Double Nickase Plasmid (m)

Ask
View Details