Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4452 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4452 Accession Number: MIMAT0018974 Mature Sequence: UUGAAUUCUUGGCCUUAAGUGAU hsa-miR-4452 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4452 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4452 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

MASP2 Mouse Monoclonal Antibody (HRP conjugated) [Clone ID: OTI2F10]
TA812533BM 100 µL

MASP2 Mouse Monoclonal Antibody (HRP conjugated) [Clone ID: OTI2F10]

Sign In for Pricing
View Details
Epha2 3'UTR GFP Stable Cell Line
TU254027 1.0 mL

Epha2 3'UTR GFP Stable Cell Line

Sign In for Pricing
View Details
Human ZRANB1 Pre-designed siRNA Set A
SI019157A 1 Each

Human ZRANB1 Pre-designed siRNA Set A

Sign In for Pricing
View Details
PLV3-U6-Tmed9-shRNA1-CopGFP-Puro Plasmid
PVT76416 2 µg

PLV3-U6-Tmed9-shRNA1-CopGFP-Puro Plasmid

Sign In for Pricing
View Details
RGPD2 3'UTR Lenti-reporter-Luc Vector
39459081 1.0 µg

RGPD2 3'UTR Lenti-reporter-Luc Vector

Sign In for Pricing
View Details
Lentiviral mouse Pgm5 shRNA (UAS) - Lentiviral mouse Pgm5 shRNA (UAS, RFP) (25)
GTR15172271 1 Vial

Lentiviral mouse Pgm5 shRNA (UAS) - Lentiviral mouse Pgm5 shRNA (UAS, RFP) (25)

Sign In for Pricing
View Details