Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-3714 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-3714 Accession Number: MIMAT0018165 Mature Sequence: GAAGGCAGCAGUGCUCCCCUGU hsa-miR-3714 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-3714 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-3714 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

GRM6 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
22696111 3 x 1.0 µg

GRM6 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

Ask
View Details
DNAJC21 Adenovirus (Human)
18402051 1.0 ml

DNAJC21 Adenovirus (Human)

Ask
View Details
Magic™ Membrane Protein Human MUSTN1 (Musculoskeletal, embryonic nuclear protein 1) expressed in Sf9 for Antibody Discovery
MP0084Q Each

Magic™ Membrane Protein Human MUSTN1 (Musculoskeletal, embryonic nuclear protein 1) expressed in Sf9 for Antibody Discovery

Ask
View Details
Tyrosine Hydroxylase (TH) Mouse Monoclonal Antibody [Clone:2D4]
E45M13872 100 ug

Tyrosine Hydroxylase (TH) Mouse Monoclonal Antibody [Clone:2D4]

Ask
View Details
Exoc8 (NM_198103) Mouse Tagged ORF Clone
MG210238 10 µg

Exoc8 (NM_198103) Mouse Tagged ORF Clone

Ask
View Details