Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4280 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4280 Accession Number: MIMAT0016911 Mature Sequence: GAGUGUAGUUCUGAGCAGAGC hsa-miR-4280 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4280 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4280 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

PI 3 Kinase p85 alpha (PIK3R1) (NM_181504) Human Over-expression Lysate
LC403621 20 µg

PI 3 Kinase p85 alpha (PIK3R1) (NM_181504) Human Over-expression Lysate

Ask
View Details
WDR5-0103
MBS578256 Inquire

WDR5-0103

Ask
View Details
NFKBIL1 (NM_005007) Human Mass Spec Standard
PH311251 10 µg

NFKBIL1 (NM_005007) Human Mass Spec Standard

Ask
View Details
CNKSR2 Antibody - C-terminal region: FITC (ARP65739_P050-FITC)
ARP65739_P050-FITC 100 µL

CNKSR2 Antibody - C-terminal region: FITC (ARP65739_P050-FITC)

Ask
View Details
LPA Antibody - middle region: HRP (ARP60281_P050-HRP)
ARP60281_P050-HRP 100 µL

LPA Antibody - middle region: HRP (ARP60281_P050-HRP)

Ask
View Details