Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4428 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4428 Accession Number: MIMAT0018943 Mature Sequence: CAAGGAGACGGGAACAUGGAGC hsa-miR-4428 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4428 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4428 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Pomc Rabbit Polyclonal Antibody
TA363884 400 µg

Pomc Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
Lats1 (NM_010690) Mouse Tagged ORF Clone Lentiviral Particle
MR226114L3V 200 µL

Lats1 (NM_010690) Mouse Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
LAGE3 Human shRNA Plasmid Kit (Locus ID 8270)
TR319422 1 Kit

LAGE3 Human shRNA Plasmid Kit (Locus ID 8270)

Sign In for Pricing
View Details
Uhrf1bp1l-set siRNA/shRNA/RNAi Lentivector (Rat)
49154096 4x 500 ng

Uhrf1bp1l-set siRNA/shRNA/RNAi Lentivector (Rat)

Sign In for Pricing
View Details
MOAP1 (Modulator of Apoptosis 1, MAP-1, MAP1, Paraneoplastic Antigen Ma4, PNMA4) (MaxLight 550)
129776-ML550 100 µL

MOAP1 (Modulator of Apoptosis 1, MAP-1, MAP1, Paraneoplastic Antigen Ma4, PNMA4) (MaxLight 550)

Sign In for Pricing
View Details
ML365
C12002 2 mg

ML365

Sign In for Pricing
View Details