Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-19b-2-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-19b-2-5p Accession Number: MIMAT0004492 Mature Sequence: AGUUUUGCAGGUUUGCAUUUCA hsa-miR-19b-2-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-19b-2-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-19b-2-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

TrkA (NTRK1) (NM_001012331) Human Tagged ORF Clone
RC213091 10 µg

TrkA (NTRK1) (NM_001012331) Human Tagged ORF Clone

Ask
View Details
CHRNA5 AAV Vector (Human) (CMV)
16126101 1 μg

CHRNA5 AAV Vector (Human) (CMV)

Ask
View Details
PQLC1 Double Nickase Plasmid (m)
sc-426282-NIC 20 µg

PQLC1 Double Nickase Plasmid (m)

Ask
View Details
Rabbit Polyclonal ADAM28 Antibody [Alexa Fluor 488]
NBP2-67246AF488 0.1 mL

Rabbit Polyclonal ADAM28 Antibody [Alexa Fluor 488]

Ask
View Details
Bovine Hyccin (FAM126A) ELISA kit
EIA07049Bo 96 Well

Bovine Hyccin (FAM126A) ELISA kit

Ask
View Details
Mouse GITR/TNFRSF18 Alexa Fluor 750 Antibody (Clone 108619)
FAB5241S-100UG 100 µg

Mouse GITR/TNFRSF18 Alexa Fluor 750 Antibody (Clone 108619)

Ask
View Details