Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-483-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-483-5p Accession Number: MIMAT0004761 Mature Sequence: AAGACGGGAGGAAAGAAGGGAG hsa-miR-483-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-483-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-483-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

Mouse ZFP42 shRNA Plasmid
abx973466-01 150 µg

Mouse ZFP42 shRNA Plasmid

Ask
View Details
Mouse ZFP42 shRNA Plasmid
abx973466-02 300 µg

Mouse ZFP42 shRNA Plasmid

Ask
View Details
p-PKC θ (A-4):m-IgGκ BP-HRP Bundle
sc-535064 1 Kit

p-PKC θ (A-4):m-IgGκ BP-HRP Bundle

Ask
View Details
Mouse Monoclonal Cytokeratin 19 Antibody (A53-B/A2.26 + BA17) - IHC-Prediluted
NBP2-44825 7 mL

Mouse Monoclonal Cytokeratin 19 Antibody (A53-B/A2.26 + BA17) - IHC-Prediluted

Ask
View Details
Rgs14 (NM_016758) Mouse Tagged Lenti ORF Clone
MR208709L3 10 µg

Rgs14 (NM_016758) Mouse Tagged Lenti ORF Clone

Ask
View Details