Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-3164 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-3164 Accession Number: MIMAT0015038 Mature Sequence: UGUGACUUUAAGGGAAAUGGCG hsa-miR-3164 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-3164 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-3164 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Lentiviral human NDUFB2 sgRNA gene knockout kit - Lentiviral human NDUFB2 sgRNA gene knockout kit (25)
GTR15363450 1 Vial

Lentiviral human NDUFB2 sgRNA gene knockout kit - Lentiviral human NDUFB2 sgRNA gene knockout kit (25)

Sign In for Pricing
View Details
Prap1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3683506 1.0 µg DNA

Prap1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

Sign In for Pricing
View Details
ATP6AP1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV655322 1.0 µg DNA

ATP6AP1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

Sign In for Pricing
View Details
Isowyosine
TRC-I918635-10MG 10 mg

Isowyosine

Sign In for Pricing
View Details
CCDC58 (NM_001017928) Human Tagged ORF Clone Lentiviral Particle
RC209383L2V 200 µL

CCDC58 (NM_001017928) Human Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
GAS2L3 sgRNA CRISPR Lentivector set (Human)
K0841701 3x 1.0 µg

GAS2L3 sgRNA CRISPR Lentivector set (Human)

Sign In for Pricing
View Details