Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-3164 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-3164 Accession Number: MIMAT0015038 Mature Sequence: UGUGACUUUAAGGGAAAUGGCG hsa-miR-3164 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-3164 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-3164 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

Mouse Cacnb2 ELISA KIT
ELI-24997m 96 Tests

Mouse Cacnb2 ELISA KIT

Ask
View Details
FHIT (Fragile Histidine Triad Protein, AP3A Hydrolase, AP3Aase, Bis(5'-adenosyl)-triphosphatase, Diadenosine 5',5'''-P1,P3-triphosphate Hydrolase, Dinucleosidetriphosphatase, FRA3B) (MaxLight 550)
MBS6211511-01 0.1 mL

FHIT (Fragile Histidine Triad Protein, AP3A Hydrolase, AP3Aase, Bis(5'-adenosyl)-triphosphatase, Diadenosine 5',5'''-P1,P3-triphosphate Hydrolase, Dinucleosidetriphosphatase, FRA3B) (MaxLight 550)

Ask
View Details
FHIT (Fragile Histidine Triad Protein, AP3A Hydrolase, AP3Aase, Bis(5'-adenosyl)-triphosphatase, Diadenosine 5',5'''-P1,P3-triphosphate Hydrolase, Dinucleosidetriphosphatase, FRA3B) (MaxLight 550)
MBS6211511-02 5x 0.1 mL

FHIT (Fragile Histidine Triad Protein, AP3A Hydrolase, AP3Aase, Bis(5'-adenosyl)-triphosphatase, Diadenosine 5',5'''-P1,P3-triphosphate Hydrolase, Dinucleosidetriphosphatase, FRA3B) (MaxLight 550)

Ask
View Details
Rabbit anti-Chicken IgG (lgY) Heavy and Light Chain Antibody FITC Conjugated
A30-107F 1 mg

Rabbit anti-Chicken IgG (lgY) Heavy and Light Chain Antibody FITC Conjugated

Ask
View Details
Tmppe (NM_001200002) Mouse Tagged ORF Clone
MR229962 10 µg

Tmppe (NM_001200002) Mouse Tagged ORF Clone

Ask
View Details
Rabbit Polyclonal Calbindin D-28K Antibody
NBP2-99063-50ul 50 µL

Rabbit Polyclonal Calbindin D-28K Antibody

Ask
View Details