CD79A Recombinant Protein

Antigen receptors found on the surface of B cells contain a heterodimeric signaling component composed of CD79A and CD79B, also known as Ig α and Ig β, respectively. Presence of this receptor complex is essential for B-cell development and function. Together these two proteins and the associated B cell receptor initiate intracellular signaling following antigen binding. An immunoreceptor tyrosine-based activation motif (ITAM) found in the CD79A intracellular region appears to be important for its function. Antigen binding precedes formation of the CD79A and CD79B heterodimer and subsequent activation of receptor associated kinases. Research has shown that CD79A is a marker for B-lineage lymphoblastic leukemia. Additionally, investigators have found that mutations in the CD79A (MB1) gene are associated with abnormally low levels of functional B cell receptors in some cases of chronic B cell lymphocytic leukemia.

CTGTGGATGCATAAAGTGCCGGCCAGCCTGATGGTTAGCCTGGGCGAAGATGCACACTTCCAGTGTCCGCATAATAGTAGTAATAATGCAAATGTGACCTGGTGGCGCGTGCTGCATGGTAATTATACCTGGCCGCCGGAATTCCTGGGTCCGGGTGAAGATCCGAATGGTACCCTGATTATTCAGAATGTTAATAAAAGCCACGGCGGTATCTATGTGTGTCGTGTTCAGGAAGGCAATGAAAGTTATCAGCAGAGCTGTGGTACCTATCTGCGTGTTCGTCAGCCGCCGCCGCGCCCGTTCTTAGATATGGGTGAAGGTACCAAAAATCGT